Sequence ID | >WENV170644146 |
Genome ID | JMBV01047375 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 95 |
End posion on genome | 20 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tacaggaatg |
tRNA gene sequence |
GGGGCAATAGCTCAGCTGGAAGAGCACCTGCGTCACATGTAGGGGGTCACAGGTTCAAGT |
Downstream region at tRNA end position |
ccattcttta |
Secondary structure (Cloverleaf model) | >WENV170644146 Val CAC g CCCA ccattcttta G - C G - C G - C G - C C - G A - T A - T T G T T G T C C A C G A A | | | | | A T C T C G A C A G G C G | | | | T T G G A G C A A A GGGTC C - G C - G T - A G + T C - G G T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |