Sequence ID | >WENV170644148 |
Genome ID | JMBV01047977 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 106 |
End posion on genome | 13 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agtttgttac |
tRNA gene sequence |
GGAGAGGTGGCCGAGTTGGTCGAAGGCGGTCGCCTGCTAAGCGATTATACGGCTTAAAAC |
Downstream region at tRNA end position |
taaaataaag |
Secondary structure (Cloverleaf model) | >WENV170644148 Ser GCT c GCCA taaaataaag G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATACGGCTTAAAACCGTATC G + T T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |