Sequence ID | >WENV170644151 |
Genome ID | JMBV01048200 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 180 |
End posion on genome | 108 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tacgattctg |
tRNA gene sequence |
GGGGGGATCGGCTAGTGGTAGGCCAACAGACTCTGGATCTGTCTGCGGAGGTTCGAATCC |
Downstream region at tRNA end position |
ggtgcagcgg |
Secondary structure (Cloverleaf model) | >WENV170644151 Gln CTG g CCAt ggtgcagcgg G G G A G - C G - C G - C G - C A - T T A T C C T C C A G A C | | | | | G T T C G G G G A G G C G + | | | T T G G G C C T A A CTGC A - T C - G A - T G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |