Sequence ID | >WENV170644161 |
Genome ID | JMBV01049257 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 113 |
End posion on genome | 188 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ccattaacta |
tRNA gene sequence |
GCTGGCGTAGCTCAACTGGCAGAGCAGCTGACTTGTAATCAGCAGGTTGCGGGTTCGAGT |
Downstream region at tRNA end position |
ttttttttaa |
Secondary structure (Cloverleaf model) | >WENV170644161 Thr TGT a TCCA ttttttttaa G - C C - G T - A G - C G - C C - G G - C T G T T A C C C A C A A A + | | | G T C T C G G C G G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |