Sequence ID | >WENV170644175 |
Genome ID | JMBW01000051 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 5822 |
End posion on genome | 5900 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaatttaatT |
tRNA gene sequence |
GGCCCCATGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACCCGGGTTCGAGTC |
Downstream region at tRNA end position |
aaattaaaag |
Secondary structure (Cloverleaf model) | >WENV170644175 Glu TTC T ACCA aaattaaaag G - C G + T C - G C - G C - G C - G A G C C T G G T G G C C G A G + | T G A C T G G G T T C G G | | | G A T A G A C T A A TAACCCG C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |