Sequence ID | >WENV170644176 |
Genome ID | JMBW01000068 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 8666 |
End posion on genome | 8590 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
attattataa |
tRNA gene sequence |
GTACCCTTAGCTCAGCTGGATAGAGTGTCTGACTACGAATCAGAAGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
gtgtaaatgc |
Secondary structure (Cloverleaf model) | >WENV170644176 Arg ACG a GCCA gtgtaaatgc G - C T - A A - T C - G C - G C - G T - A T A T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | + T T G G A G T A T A G AGGTC T - A C - G T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |