Sequence ID | >WENV170644186 |
Genome ID | JMBW01000211 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6146 |
End posion on genome | 6058 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttagttttat |
tRNA gene sequence |
GCCGAAGTGGTGGAACTGGCAGACGCGTTGGACTCAAAATCCAATGGTAGCAATACCGTG |
Downstream region at tRNA end position |
tacaattcac |
Secondary structure (Cloverleaf model) | >WENV170644186 Leu CAA t ACCA tacaattcac G - C C - G C - G G - C A - T A - T G - C T T T C C C C C A C A A G | | | | | G T G G T G G G G G G C G | + | T T G A C G C C A G G TGGTAGCAATACCGTGG T - A T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |