Sequence ID | >WENV170644187 |
Genome ID | JMBW01000213 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 4608 |
End posion on genome | 4533 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cgttctttgC |
tRNA gene sequence |
GTTCCCGTGGCCTAACGGATAAGGCACTGGCCTCCGAAGCCAGTCATGTGGGTTCGATTC |
Downstream region at tRNA end position |
ttttctttta |
Secondary structure (Cloverleaf model) | >WENV170644187 Arg CCG C GACA ttttctttta G G T + G T + G C - G C - G C - G G - C T T T C A C C C A C A A G | | | | | G G T C C G G T G G G C G | | | | T T A A G G C T A A TCAT C - G T - A G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |