Sequence ID | >WENV170644188 |
Genome ID | JMBW01000217 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 4610 |
End posion on genome | 4698 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtgcctgccc |
tRNA gene sequence |
GGAGAGGTCGCATAGTTGGTCTAGTGCGCTCGCTTGGAAAGCGAGTATACCGAGAGGTAT |
Downstream region at tRNA end position |
tataatagtc |
Secondary structure (Cloverleaf model) | >WENV170644188 Ser GGA c GCCT tataatagtc G - C G - C A - T G - C A - T G - C G - C T A T T T C C C A T T G A C | | | | | G G T A C G A A G G G C G + | | | T T T G T G C C T A G TATACCGAGAGGTATC C - G T - A C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |