Sequence ID | >WENV170644189 |
Genome ID | JMBW01000226 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 484 |
End posion on genome | 574 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ttttatttat |
tRNA gene sequence |
GGAGAGATGTCCGAGAGGTTGAAGGTGGTGGTCTCGAAAACCACTGTACAGGCATTCTGT |
Downstream region at tRNA end position |
ttagatttta |
Secondary structure (Cloverleaf model) | >WENV170644189 Ser CGA t GCCA ttagatttta G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A A G A G | | | | | G G G C C T G A G G G C G | | T T T A G G T T G A G TGTACAGGCATTCTGTACC G - C T - A G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |