Sequence ID | >WENV170644191 |
Genome ID | JMBW01000413 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 4416 |
End posion on genome | 4491 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ctcaaatcaa |
tRNA gene sequence |
GCCACAATAGCTCAGTTGGTAGAGTAACGCATTCGTAACGCGTGGGTCGCGAGTTCAAGT |
Downstream region at tRNA end position |
ctcatgaaaa |
Secondary structure (Cloverleaf model) | >WENV170644191 Thr CGT a TCTA ctcatgaaaa G - C C - G C - G A - T C - G A - T A - T T G T C G C T C A T G A A | | | | | A T C T C G G C G A G C G | | | + T T G G A G T T A A GGGTC A - T C - G G - C C - G A C T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |