Sequence ID | >WENV170644193 |
Genome ID | JMBW01000540 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 4636 |
End posion on genome | 4560 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
attaaattgt |
tRNA gene sequence |
GGGCCTGTAGCTCAGGTGGTAAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
cttagacaat |
Secondary structure (Cloverleaf model) | >WENV170644193 Ile GAT t ACCA cttagacaat G - C G - C G - C C - G C - G T - A G + T T G T C C A C C A G G A A | | | | | G T C T C G G G T G G C G | | | | T T G G A G C T A A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |