Sequence ID | >WENV170644197 |
Genome ID | JMBW01000572 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3619 |
End posion on genome | 3544 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gaaagtaccT |
tRNA gene sequence |
AGGTCAGTAGCTCAATTGGCAGAGCACCGCTCTCCAAAAGCGGGGGGCTGAGGGTTCGAG |
Downstream region at tRNA end position |
atgttgattt |
Secondary structure (Cloverleaf model) | >WENV170644197 Trp CCA T GTtg atgttgattt A - T G - C G - C T - A C - G A - T G - C T G T C T T C C A T A A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C C A A GGGGCT C - G C - G G - C C - G T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |