Sequence ID | >WENV170644200 |
Genome ID | JMBW01000815 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1420 |
End posion on genome | 1343 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gcaacttgcC |
tRNA gene sequence |
CCCCCAGTGGCTCAATGGATAGAGCAAGGCACTCCTAACGCCTGGATTGGGGGGGGTTCG |
Downstream region at tRNA end position |
taaaagaaaa |
Secondary structure (Cloverleaf model) | >WENV170644200 Arg CCT C GGta taaaagaaaa C - G C - G C - G C - G C - G A - T G - C T T T C T C C C A T A A G | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T A A GGATTGGG A - T G - C G - C C - G A C C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |