Sequence ID | >WENV170644205 |
Genome ID | JMBW01000872 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 200 |
End posion on genome | 129 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tagaacttac |
tRNA gene sequence |
GCGGGCGTCGCCAAGTGGTAAGGCATTAGCCTTCCAAGCTAACATTCGTCGGTTCGAATC |
Downstream region at tRNA end position |
ttttctttta |
Secondary structure (Cloverleaf model) | >WENV170644205 Gly TCC c Tttt ttttctttta G - C C - G G - C G - C G - C C - G G - C T A T T A G C C A G A C + | | | | G T A C C G G T C G G C G | | | T T G A G G C T A A CATTC T - A T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |