Sequence ID | >WENV170644211 |
Genome ID | JMBW01001190 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3126 |
End posion on genome | 3200 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cgatgatagt |
tRNA gene sequence |
TCCGGGATTGTGTAGCTGGTAGCACCTGTGACTCTGGATCACATAGCCTAGGTTCGAATC |
Downstream region at tRNA end position |
atttaatact |
Secondary structure (Cloverleaf model) | >WENV170644211 Gln CTG t GCCA atttaatact T - A C - G C - G G - C G - C G - C A - T T A T G A T C C A C G A T | | | | | G T T G T G C T A G G C G + | | | T T G G C A C T A C TAGC T - A G - C T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |