Sequence ID | >WENV170644212 |
Genome ID | JMBW01001190 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3213 |
End posion on genome | 3293 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
taatactatG |
tRNA gene sequence |
GCCCCCATGGTCAAGAGGTTAAGATATCGCCCTCTCACGGCGAAGTCAGGGGGGGTTCGA |
Downstream region at tRNA end position |
Aataaggttt |
Secondary structure (Cloverleaf model) | >WENV170644212 Glu CTC G TACC Aataaggttt G - C C - G C - G C - G C - G C - G A G C T T T T C C C T A G A G + + | | A G A C T G G G G G T G G | | + T C T A G A T T A A AGTCAGGG T - A C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |