Sequence ID | >WENV170644214 |
Genome ID | JMBW01001207 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 529 |
End posion on genome | 617 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ccataatcgg |
tRNA gene sequence |
GCAGGCGTGGCGGAATTGGCAGACGCGCTAGACTTAGGATCTAGTGGGTATTCCCCCCCG |
Downstream region at tRNA end position |
ttttttttgt |
Secondary structure (Cloverleaf model) | >WENV170644214 Leu TAG g ACCA ttttttttgt G - C C - G A - T G - C G - C C - G G - C T C T C T C T C A T A A G | | | | | G T G G C G G A G A G C G | | | T T G A C G C C A G G TGGGTATTCCCCCCCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |