Sequence ID | >WENV170644216 |
Genome ID | JMBW01001322 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1974 |
End posion on genome | 1901 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
agtccgaaac |
tRNA gene sequence |
TGTCTTATGGTGTAATGGTAGCACAACAGATTCTGGTCCTGTTTGTCCAGGTTCGAGTCC |
Downstream region at tRNA end position |
cgctgctacg |
Secondary structure (Cloverleaf model) | >WENV170644216 Gln CTG c ACAA cgctgctacg T - A G - C T - A C - G T - A T - A A - T T G T G G T C C A A A G | | | | | G T T G T G C C A G G C G + | | | T T G G C A C T A A TTGT A - T C - G A - T G - C A C T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |