Sequence ID | >WENV170644219 |
Genome ID | JMBW01001540 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1168 |
End posion on genome | 1254 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aataaatatt |
tRNA gene sequence |
GCCGGTGTGTTGGAATTGGCAGACGAGACGGACTCAAAATCCGTTGCCACTAGTGGCGTG |
Downstream region at tRNA end position |
attagaaaaa |
Secondary structure (Cloverleaf model) | >WENV170644219 Leu CAA t ACCA attagaaaaa G - C C - G C - G G - C G - C T - A G - C T G T C A C C C A T A A G | | | | | G T G G T T G T G G G C G | + | T T G A C G A C A G G TGCCACTAGTGGCGT A - T C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |