Sequence ID | >WENV170644222 |
Genome ID | JMBW01001668 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 2606 |
End posion on genome | 2681 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ccattgtgcc |
tRNA gene sequence |
CCCCCCATCGTCTAGTGGCCTAGGATATCGCCCTCTCACGGCGGGGACACCGGTTCAAAT |
Downstream region at tRNA end position |
ttataaagat |
Secondary structure (Cloverleaf model) | >WENV170644222 Glu CTC c ACCA ttataaagat C T C - G C - G C - G C - G C - G A - T T A T T G G C C A T G A C | | | | | A G T C T G A C C G G C G + | | + T T C G G A T C T A A GGAC T + G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |