Sequence ID | >WENV170644229 |
Genome ID | JMBW01001744 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1411 |
End posion on genome | 1485 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tgagtacagg |
tRNA gene sequence |
GCGGATGTGGCTCAATGGTAGAGCATCGGCTTCCCAAGCCGAGGGTTGCGAGTTCGAATC |
Downstream region at tRNA end position |
tttctatgct |
Secondary structure (Cloverleaf model) | >WENV170644229 Gly CCC g TCCA tttctatgct G - C C - G G - C G - C A - T T + G G - C T A T T G C T C A A A G + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTT T - A C - G G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |