Sequence ID | >WENV170644230 |
Genome ID | JMBW01001744 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1493 |
End posion on genome | 1571 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccatttctat |
tRNA gene sequence |
GCTGGCGTGGCTCAGTTGGCAGAGCGGTTGATTCGTAATCAACAGGTCAGGGGGGGTTCG |
Downstream region at tRNA end position |
ttattaagaa |
Secondary structure (Cloverleaf model) | >WENV170644230 Thr CGT t TCCA ttattaagaa G - C C - G T - A G - C G - C C - G G - C T C T T C C C C A T G A G + | | | | G T C T C G G G G G G C G | | | | T T G G A G C C A G AGGTCAGG G - C T - A T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |