Sequence ID | >WENV170644231 |
Genome ID | JMBW01001773 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1576 |
End posion on genome | 1675 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
acaactaaat |
tRNA gene sequence |
GGGAGTAGATGGGTGCTGGTGTGCCCTCTGGTCTTCAAAACCAGTATGAGGGGGGGTTAG |
Downstream region at tRNA end position |
tataagtaat |
Secondary structure (Cloverleaf model) | >WENV170644231 SeC(p) TCA t GCCA tataagtaat G - C G - C G - C A - T G - C T - A A - T G A T T A C A C C C A T C G T | | | | | G G T G G G G T G G G C G + | | | T T T G C C C G T T TATGAGGGGGGGTTAGGAGCTTCTTGG C - G T - A G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |