Sequence ID | >WENV170644232 |
Genome ID | JMBW01001853 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 874 |
End posion on genome | 795 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gacgtagtgG |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTTGTCGGTTCGAA |
Downstream region at tRNA end position |
tgcatgctaa |
Secondary structure (Cloverleaf model) | >WENV170644232 Met CAT G ACCA tgcatgctaa C A G - C C - G G - C G - C G - C G - C C C T C C C G G T T G A G | | + + A C C G A G C G G T T A T | | | | C G G G C T C G T A G AGGTTGT T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |