Sequence ID | >WENV170644233 |
Genome ID | JMBW01001938 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1134 |
End posion on genome | 1209 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tgattttcgg |
tRNA gene sequence |
GGGGGCGTAGCGCAGATGGAAGCGCGTTGGTTTCGGGAACCAAAGGTCGCTGGTTCAAAT |
Downstream region at tRNA end position |
tagattaaaa |
Secondary structure (Cloverleaf model) | >WENV170644233 Pro CGG g ACCA tagattaaaa G G G - C G - C G - C G + T C - G G - C T A T T G A C C A A G A A + | | | | A T C G C G G C T G G C G | | | | T T G G C G C A A G AGGTC T - A T - A G - C G - C T - A T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |