Sequence ID | >WENV170644234 |
Genome ID | JMBW01001946 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 159 |
End posion on genome | 85 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
attatttaat |
tRNA gene sequence |
GGCGAGATAGCTCAGTTGGTTAGAGCGCATGATTCATAATCATGAGGTCCCGGGATCATG |
Downstream region at tRNA end position |
tcacaatcaa |
Secondary structure (Cloverleaf model) | >WENV170644234 Met CAT t ACat tcacaatcaa G + T G - C C - G G - C A - T G - C A - T C G T G G C C C T T G A A | | | | | A T C T C G C C G G G C G | | | | A T G G A G C T T A G AGGTC C - G A - T T - A G - C A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |