Sequence ID | >WENV170644235 |
Genome ID | JMBW01002017 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 189 |
End posion on genome | 263 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ttttcattta |
tRNA gene sequence |
GGGGTTGTAGCGCAGCGGGAGCGCGTTGCCTTCGCAAGGCAAAGGCCGTGGGTTCGAATC |
Downstream region at tRNA end position |
aaataaaaaa |
Secondary structure (Cloverleaf model) | >WENV170644235 Ala CGC a ACCA aaataaaaaa G - C G - C G + T G - C T - A T - A G - C T A T T A C C C A G A A + | | | | G C C G C G G T G G G C G | | | | T T G G C G C G A G AGGCC T - A T - A G - C C - G C - G T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |