Sequence ID | >WENV170644242 |
Genome ID | JMBW01002338 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1857 |
End posion on genome | 1936 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
taaagtatct |
tRNA gene sequence |
CGGGATGTGGCTCAGTTTGGTAGAGTACAAGTCTGGGGGACTTGGGGGGGTCGCTGGTTC |
Downstream region at tRNA end position |
tgttttaatt |
Secondary structure (Cloverleaf model) | >WENV170644242 Pro GGG t ACCA tgttttaatt C - G G - C G - C G - C A - T T - A G - C T A T T G A C C A T G A G + | | | | G T C T C G G C T G G C T | | | + T T G G A G T G T A A GGGGGGTC C - G A - T A - T G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |