Sequence ID | >WENV170644243 |
Genome ID | JMBW01002341 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1635 |
End posion on genome | 1714 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
actggagtta |
tRNA gene sequence |
CGGGGCGTGGCTCAGTTTGGTAGAGCGTCGCGTTCGGGACGCGAAGGCCGCACGTTCAAA |
Downstream region at tRNA end position |
tctttaatta |
Secondary structure (Cloverleaf model) | >WENV170644243 Pro CGG a ACCA tctttaatta C - G G - C G - C G - C G - C C C G - C T G T C G C T G C T G A G | T T C T C G C G T T C A T | | | | A A G G A G C G T A G AGGCCGCA T - A C - G G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |