Sequence ID | >WENV170644244 |
Genome ID | JMBW01002387 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 107 |
End posion on genome | 183 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
atttgtctaa |
tRNA gene sequence |
GGGCTAGTAGCTCAGTTGGTGAGAGCGCACGCCTGATAAGCGTGAGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
agcagaatat |
Secondary structure (Cloverleaf model) | >WENV170644244 Ile GAT a ACCA agcagaatat G - C G - C G - C C - G T - A A - T G - C T A T C C T C C A T G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C T G A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |