Sequence ID | >WENV170644246 |
Genome ID | JMBW01002396 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 911 |
End posion on genome | 985 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
attgaagatc |
tRNA gene sequence |
GGGGAATTAGCTCAGCTGGCTAGAGCATCTGCCTTGCACGCAGAGGGTCAACGGTTCGAA |
Downstream region at tRNA end position |
tattgattta |
Secondary structure (Cloverleaf model) | >WENV170644246 Ala TGC c ACag tattgattta G - C G - C G + T G - C A - T A - T T - A T A T T T G C C A C G A A | | | | | G T C T C G A A C G G C G | | | | T T G G A G C C T A A GGGTC T - A C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |