Sequence ID | >WENV170644247 |
Genome ID | JMBW01002400 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 2027 |
End posion on genome | 1954 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gcagcaatgg |
tRNA gene sequence |
GGGGGGATCGTCTAATGGCAGGACGGATGACTCTGACTCATCTAGTCTAGGTTCGAATCC |
Downstream region at tRNA end position |
tatgtatcag |
Secondary structure (Cloverleaf model) | >WENV170644247 Gln CTG g GCCA tatgtatcag G A G - C G - C G - C G - C G - C A - T T A T G A T C C A A A C | | | | | G T T C T G C T A G G C G + | | | T T G G G A C C A G TAGT G - C A - T T - A G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |