Sequence ID | >WENV170644250 |
Genome ID | JMBW01002522 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1934 |
End posion on genome | 1857 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aataatttcg |
tRNA gene sequence |
GGGGGTGTAGCACAGTCCGGTTAGTGTACCTGCTTTGGGAGCAGGGGGTCGCGAGTTCGA |
Downstream region at tRNA end position |
cggtgaaaat |
Secondary structure (Cloverleaf model) | >WENV170644250 Pro TGG g CCGA cggtgaaaat G - C G - C G - C G - C G - C T - A G - C T A T C G C C C A C T G A A | | | | G C C A C G G C G A G C G | | | + T T G G T G T T T A A GGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |