Sequence ID | >WENV170644254 |
Genome ID | JMBW01002830 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 374 |
End posion on genome | 450 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccgaaacaga |
tRNA gene sequence |
GGTCCCATAGCTCAGTTGGTTAGAGCACCTGACTCATAATCAGGGAGTCACTGGTTCAAG |
Downstream region at tRNA end position |
aataacaggc |
Secondary structure (Cloverleaf model) | >WENV170644254 Met CAT a ACCA aataacaggc G - C G - C T - A C - G C - G C - G A - T C G T T G A C C A T G A A | | | | | A T C T C G A C T G G C G | | | | T T G G A G C T T A A GAGTC C - G C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |