Sequence ID | >WENV170644256 |
Genome ID | JMBW01002843 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1829 |
End posion on genome | 1755 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
taaaaatcat |
tRNA gene sequence |
CGGGATGTAGCACAGTTGGCTAGCGCGCCACGTTCGGGACGTGGAGGTCGGGTGTTCGAG |
Downstream region at tRNA end position |
acataataaa |
Secondary structure (Cloverleaf model) | >WENV170644256 Pro CGG t ACtt acataataaa C - G G - C G - C G - C A - T T - A G - C T G T T C C A C A T G A A + | | | | G T C A C G G G G T G C G | | | T T G G C G C C T A G AGGTC C - G C - G A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |