Sequence ID | >WENV170644259 |
Genome ID | JMBW01003141 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1037 |
End posion on genome | 1125 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtgcctgccc |
tRNA gene sequence |
GCAGAGATCGCATAGTTGGTCTAGTGCGCTCGCTTGGAAAGCGAGTATACCGAGAGGTAT |
Downstream region at tRNA end position |
tagattgata |
Secondary structure (Cloverleaf model) | >WENV170644259 Ser GGA c GCCT tagattgata G - C C C A - T G - C A - T G - C A - T T A T T T C C C A T T G A C | | | | | G G T A C G A A G G G C G + | | | T T T G T G C C T A G TATACCGAGAGGTATC C - G T - A C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |