Sequence ID | >WENV170644261 |
Genome ID | JMBW01003144 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 958 |
End posion on genome | 1031 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
acatttgacc |
tRNA gene sequence |
GCGGGTGTAGTTCAATTGGTAGAACGTCTCCTTGCCAAGGAGAAGGTCGTGAGTTCGAGT |
Downstream region at tRNA end position |
taccagactg |
Secondary structure (Cloverleaf model) | >WENV170644261 Gly GCC c TCtt taccagactg G - C C - G G - C G - C G - C T + G G - C T G T T A C T C A T A A A + | | | | G T C T T G G T G A G C G | | | | T T G G A A C T A G AGGTC T - A C - G T - A C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |