Sequence ID | >WENV170644268 |
Genome ID | JMBW01003385 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1261 |
End posion on genome | 1349 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
atgttgattt |
tRNA gene sequence |
GGTGAGGTGCCCGAGAGGCCAAAGGGGGGGCGGACTGTAAATCCGCTGGCAGATTGCCTT |
Downstream region at tRNA end position |
atatacatgt |
Secondary structure (Cloverleaf model) | >WENV170644268 Tyr GTA t ACCA atatacatgt G - C G - C T - A G - C A - T G - C G - C T A T C T T C C A G A G A G | | | | | G G G C C C G A A G G C C | | | T T C G G G G A A A G G TGGCAGATTGCCTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |