Sequence ID | >WENV170644269 |
Genome ID | JMBW01003401 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 350 |
End posion on genome | 277 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tctttagtgT |
tRNA gene sequence |
TCCTCGGTAGCTCAATGGCAGAGCATTCGGCTGTTAACCGAAGGGTTGTTGGTTCGAGTC |
Downstream region at tRNA end position |
ccaacatgaa |
Secondary structure (Cloverleaf model) | >WENV170644269 Asn GTT T GGag ccaacatgaa T + G C - G C - G T + G C - G G - C G - C T G T C A A C C A A A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C C A A GGGTT T - A T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |