Sequence ID | >WENV170644270 |
Genome ID | JMBW01003454 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 301 |
End posion on genome | 226 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cccgttgagt |
tRNA gene sequence |
GCGCCCGTAGCTCAGTGGATAGAGTGACGGACTACGAATCCGCAGGTCGCGCGTTCGAAT |
Downstream region at tRNA end position |
tttttcggag |
Secondary structure (Cloverleaf model) | >WENV170644270 Arg ACG t GCCA tttttcggag G - C C - G G - C C - G C - G C - G G - C T A T C G C G C A T G A A | | | | | G G C T C G G C G C G C G | | | + T T A G A G T T A G AGGTC A C C - G G - C G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |