Sequence ID | >WENV170644271 |
Genome ID | JMBW01003454 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 204 |
End posion on genome | 126 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
atgtttgtgt |
tRNA gene sequence |
GGCCCTGTAGCTCAGGGGGGGATAGAGCAGTGGTTTCCTAAACCATTGGCCGCAGGTTCG |
Downstream region at tRNA end position |
ttgttatggc |
Secondary structure (Cloverleaf model) | >WENV170644271 Arg CCT t ACCA ttgttatggc G - C G - C C - G C - G C - G T - A G - C T T T C G T C C A G G G A A | | | | | G G C T C G G C A G G C G | | | | T T G G A G C G A T A A TGGCC G + T T - A G - C G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |