Sequence ID | >WENV170644277 |
Genome ID | JMBW01003969 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1479 |
End posion on genome | 1568 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
atccaactac |
tRNA gene sequence |
GGAGAGGTGACCGAGTGGCCGAAGGTGCTTGCCTGCTAAGCAAGTGTAGAGGTAACTCTA |
Downstream region at tRNA end position |
ttgtttattg |
Secondary structure (Cloverleaf model) | >WENV170644277 Ser GCT c GCCA ttgtttattg G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C A G A G G G C G | | | T T C A G G T C G A G TGTAGAGGTAACTCTACC C - G T - A T - A G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |