Sequence ID | >WENV170644279 |
Genome ID | JMBW01004303 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1167 |
End posion on genome | 1080 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
taagtaaaaa |
tRNA gene sequence |
GCCGAGATGGCGGAACTGGTAGACGCGTAAGATTCAGGATCTTATGGGTTTTATACCCGT |
Downstream region at tRNA end position |
tatcttatcc |
Secondary structure (Cloverleaf model) | >WENV170644279 Leu CAG a ACCA tatcttatcc G - C C - G C - G G - C A - T G - C A - T T G T C G C C C A C A A G | | | | | A T G G C G G C G G G C G | | | T T G A C G C T A G G TGGGTTTTATACCCGT T - A A - T A - T G - C A - T T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |