Sequence ID | >WENV170644282 |
Genome ID | JMBW01004481 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 540 |
End posion on genome | 466 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tttatcacaa |
tRNA gene sequence |
GGGCGATTAACTCAATGGTAGAGTGTCATCTTGACGTGGTGAAAGTTACAGGTTCGAGTC |
Downstream region at tRNA end position |
aaatataaaa |
Secondary structure (Cloverleaf model) | >WENV170644282 Val GAC a ACCA aaatataaaa G - C G - C G - C C - G G - C A - T T - A T G T T G T C C A A A A | | | | | G T C T C A A C A G G C G | | | | T T G G A G T T A G AAGTT T - A C - G A - T T + G C - G T T T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |