Sequence ID | >WENV170644283 |
Genome ID | JMBW01004614 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 383 |
End posion on genome | 460 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
aatgaaacag |
tRNA gene sequence |
GGCCCTATAGTCTAGCGGTCAGGACGCCGCCCTCTCACGGCGGAAGCTGGGGGGGTTCGA |
Downstream region at tRNA end position |
acaaaagaac |
Secondary structure (Cloverleaf model) | >WENV170644283 Glu CTC g ACCA acaaaagaac G + T G - C C - G C - G C - G T - A A - T T T T A C C C C A C G A A | | | | G G T C T G G G G G G C G + | | | T T T G G A C C A G AAGCTGG C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |