Sequence ID | >WENV170644284 |
Genome ID | JMBW01004627 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6 |
End posion on genome | 96 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
nnnnngctgt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGCAGACGCGCTAGATTCAGGGTCTAGTGGGGGGGGTTAACCC |
Downstream region at tRNA end position |
ttattcttct |
Secondary structure (Cloverleaf model) | >WENV170644284 Leu CAG t ACCA ttattcttct G - C C - G C - G G - C A - T A - T G - C T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | + | T T G A C G C C A G G TGGGGGGGGTTAACCCCGT C - G T - A A - T G - C A - T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |