Sequence ID | >WENV170644285 |
Genome ID | JMBW01004701 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 561 |
End posion on genome | 651 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
taggtaattt |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGATGAAGGCGCACGCCTGGAAAGCGTGTGTACGCCGAAAGCGT |
Downstream region at tRNA end position |
attaattttt |
Secondary structure (Cloverleaf model) | >WENV170644285 Ser GGA t GCAA attaattttt G - C G - C A - T G - C A - T G - C G + T T A T T T C C C A T G A G | | | | | G G G C C G A A G G G C G | | | T T A A G G C T G A G TGTACGCCGAAAGCGTACC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |