Sequence ID | >WENV170644289 |
Genome ID | JMBW01004917 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 448 |
End posion on genome | 527 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aagaaaataa |
tRNA gene sequence |
GCCTCTTTAGCTCAGTTGGCCAGAGCACGTGATTTGTAATCTCGGGGGGGTCGTTGGTTC |
Downstream region at tRNA end position |
gtttttttta |
Secondary structure (Cloverleaf model) | >WENV170644289 Thr TGT a TCAA gtttttttta G - C C - G C - G T - A C - G T - A T - A T A T C A G C C A T G A A | | + | | G T C T C G G T T G G C G | | | | T T G G A G C C C A A GGGGGGTC C - G G - C T T G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |