Sequence ID | >WENV170644290 |
Genome ID | JMBW01004917 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 850 |
End posion on genome | 924 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cgctcttatt |
tRNA gene sequence |
GCCTATGTAGCTCAGAGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCGCGGGTTCAACTC |
Downstream region at tRNA end position |
ttacaaatga |
Secondary structure (Cloverleaf model) | >WENV170644290 Thr GGT t TCAA ttacaaatga G - C C - G C - G T C A - T T - A G - C T C T C G C C C A G A A | | | | | A A C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |